View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9981_low_28 (Length: 242)
Name: NF9981_low_28
Description: NF9981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9981_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33554556 - 33554783
Alignment:
| Q |
1 |
attaaaattcttaatcttgatcatactaaa-----gcacattaaaacataatttcaagattcaaagataaatnnnnnnngtacctagaagaagattcaag |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33554556 |
attaaaattcttaatcttgatcatactaaactaaagcacattaaaacataatttcaagattcaaagatatataaaaaaagtacctagaagaagattcaag |
33554655 |
T |
|
| Q |
96 |
ctgaacaacaagaccaccaaccttaggcaaaactacagaaaccaaagctttaagagctttagaaggacacaaaagattttctggtttgcaaaggtaacaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554656 |
ctgaacaacaagaccaccaaccttaggcaaaactacagaaaccaaagcattaagagctttagaaggacacaaaagattttctggtttgcaaaggtaacaa |
33554755 |
T |
|
| Q |
196 |
ataacatcaaccatgcaaactttcccaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33554756 |
ataacatcaaccatgcaaactttcccaa |
33554783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 223
Target Start/End: Original strand, 33542247 - 33542395
Alignment:
| Q |
75 |
gtacctagaagaagattcaagctgaacaacaagaccaccaaccttaggcaaaactacagaaaccaaagctttaagagctttagaaggacacaaaagattt |
174 |
Q |
| |
|
||||||||| |||| ||| || ||||||||||||||| |||||| | ||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
33542247 |
gtacctagatgaaggttctagatgaacaacaagaccatcaacctcattgaaaacattggaaatggaagccttaagagctttagaaggacacaaaagattt |
33542346 |
T |
|
| Q |
175 |
tctggtttgcaaaggtaacaaataacatcaaccatgcaaactttcccaa |
223 |
Q |
| |
|
|| ||||||||||| || ||||||||||||||| |||| |||||||| |
|
|
| T |
33542347 |
tcctgtttgcaaaggaaaacaataacatcaaccatacaaattttcccaa |
33542395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University