View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9982_high_3 (Length: 356)
Name: NF9982_high_3
Description: NF9982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9982_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 118 - 266
Target Start/End: Original strand, 45193764 - 45193907
Alignment:
| Q |
118 |
gttttaatatgcgacggatgtatgtactatgcactatcaacagatagatatgagctgcaaatattttttaaaattccgatttctcttgcaaaatgattnn |
217 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45193764 |
gttttaatatgtgacggatgtatgtattat----tattaatagatagatatgagctgcaaatattttttaaaattcccatttctcttgcaaaatgatt-a |
45193858 |
T |
 |
| Q |
218 |
nnnnntaaatggcggcaagctgttcttgactggccggtcatgtgctaac |
266 |
Q |
| |
|
|||||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
45193859 |
aaaaataaatggcggcaagctgtgcttggctggctggtcatgtgctaac |
45193907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 45193954 - 45194021
Alignment:
| Q |
280 |
tttttgcatttatggtgtttaggtccagggtagcaagcatatctcttgtatcagattcagccctatgc |
347 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
45193954 |
tttttgcatttatgctgtttagatccagaatagtaagcatatctcttgtttcagattcagccttatgc |
45194021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 7161662 - 7161698
Alignment:
| Q |
25 |
gatgcaagggttaaggttagggttgtttcatccggag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7161662 |
gatgcaagggttaaggttagggttgtttcatccggag |
7161698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 116 - 181
Target Start/End: Original strand, 7161754 - 7161812
Alignment:
| Q |
116 |
gagttttaatatgcgacggatgtatgtactatgcactatcaacagatagatatgagctgcaaatat |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7161754 |
gagttttaatatacgacggatgtatgtactatg-------tacagatagatatgagctgcaaatat |
7161812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 27507638 - 27507588
Alignment:
| Q |
223 |
taaatggcggcaagctgttcttgactggccggtcatgtgctaacttgtctt |
273 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||| |||||||| |
|
|
| T |
27507638 |
taaatggcggcaagctgtgcttggttggctggtcatgtgctaccttgtctt |
27507588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University