View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9983_high_2 (Length: 370)
Name: NF9983_high_2
Description: NF9983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9983_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 45512284 - 45512643
Alignment:
| Q |
1 |
catgggaagatattacaaatgtgtagtacttttggtgttgattgaaattgcacaaatatgcttgtgtgtaaattcaaacatcccctgtattgaaaaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512284 |
catgggaagatattacaaatgtgtagtacttttggtgttgattgaaattgcacaaatatgcttgtgtgtaaattcaaacatcccctgtattgaaaaagag |
45512383 |
T |
|
| Q |
101 |
aggcaagcccttctcaatttcaaagcatccattgcacatgattcaccaaacaagctttcatcatggaaaggcactcactgttgccaatgggaaggcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512384 |
aggcaagcccttctcaatttcaaagcatccattgcacatgattcaccaaacaagctttcatcatggaaaggcactcactgttgccaatgggaaggcattg |
45512483 |
T |
|
| Q |
201 |
gttgtgacaatgttactagacatgttgtcaaacttgatctcatgaatccttgtcaccaaccatcttggtcgcgagaagaagaacattttggtcactact- |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512484 |
gttgtgacaatgttactagacatgttgtcaaacttgatctcatgaatccttgtcaccaaccattttggtcgcgagaagaagaacattttggtcactacta |
45512583 |
T |
|
| Q |
300 |
--------atttggacgattacatgccttgttcaccaatagttgctccaaatgtgagctc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512584 |
tttgtacaatttggacgattacatgccttgttcaccaatagttgctccaaatgtgagctc |
45512643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University