View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9983_high_3 (Length: 321)
Name: NF9983_high_3
Description: NF9983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9983_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 54702819 - 54702661
Alignment:
| Q |
20 |
agatattggtacaaagtcaaagggggtgtgtacatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702819 |
agatattggtacaaagtcaaagggggtgtgtatatcagctaaacgatgattcagaaatggaaaatgcactgatactgggtgcagaagtagtgttcaagct |
54702720 |
T |
 |
| Q |
120 |
tcatctagagatacacagttttgaaaaataaataaattcaaatgcatattgcatgttta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702719 |
tcatctagagatacacagttttgaaaaataaataaattcaaatgcatattgcatgttta |
54702661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 263 - 311
Target Start/End: Complemental strand, 54702589 - 54702541
Alignment:
| Q |
263 |
catgtgctaaaattgctgaaataccgtcagtaacgtgtttatctctctg |
311 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
54702589 |
catgtgctaaaattgctgaaatactgtcggtaacgtgtttatctctctg |
54702541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University