View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9983_high_6 (Length: 303)
Name: NF9983_high_6
Description: NF9983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9983_high_6 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 176 - 235
Target Start/End: Original strand, 1810 - 1869
Alignment:
| Q |
176 |
gattaaggcaacatttaaaagctacgcttacaatttaaatctttgttggattaattccac |
235 |
Q |
| |
|
||||||||| | | ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1810 |
gattaaggctaaaattaaaagctacgcttacgatttaaatctttgttggattaattccac |
1869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University