View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9983_low_20 (Length: 227)
Name: NF9983_low_20
Description: NF9983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9983_low_20 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 37959695 - 37959481
Alignment:
| Q |
5 |
cgaaaatacatggaggtttaagctccaacaagtctttataaatgttcatgcattctaaaggcaaaaggcatacaaaaccgagaaacagtaaacaaattga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959695 |
cgaaaatacatggaggtttaagctccaacaagtctttataaatgttcatgcattctaaaggcaaaaggcatacaaaaccgagaaacagtaaacaaattga |
37959596 |
T |
 |
| Q |
105 |
gcttcttccgtt-gttggttaccaataattctgctgtagtgctattgctatgtcttacccaacaactccaacaacgtatgatgtgttcctcagctttata |
203 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||||||||||| | |
|
|
| T |
37959595 |
gctccttccgttggttggttaccaataattctgctatagtgctatttgtatgtctcac---------ccaacaacgtatgatgtgttcctcagctttaga |
37959505 |
T |
 |
| Q |
204 |
ggagaggacactcgtcactacttc |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37959504 |
ggagaggacactcgtcactacttc |
37959481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University