View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9984_high_1 (Length: 361)
Name: NF9984_high_1
Description: NF9984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9984_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 114 - 351
Target Start/End: Original strand, 42810857 - 42811094
Alignment:
| Q |
114 |
cccggcgcttctcaattcctcgctaatcttccccttcgcggcaccttcacttccaccgccatttcttccaatccggtacattccccctttctttcaatct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42810857 |
cccggcgcttctcaattcctcgctaatcttccccttcgcggcaccttcacttccaccgccatttcttccaatccggtacattccccctttctttcaatct |
42810956 |
T |
 |
| Q |
214 |
cattttatcgatcttccatttctattgaatttactgttataagttttatgtgaaatcccctttcattcacgtgtatggaatttcgtaaccctagcttgct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42810957 |
cattttatcgatcttccatttctattgaatttactgttataagttttatgtgaaatcccctttcattcacgtgtatggaatttcgtaaccctagcttgct |
42811056 |
T |
 |
| Q |
314 |
agtttagttgctaatgtgtatgcgattgtagatttcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42811057 |
agtttagttgctaatgtgtatgcgattgtagatttcat |
42811094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 53
Target Start/End: Original strand, 42810732 - 42810770
Alignment:
| Q |
15 |
aaaaagttcagtcttctgccttctcttcttttctcttct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42810732 |
aaaaagttcagtcttctgccttctcttctcttctcttct |
42810770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 96
Target Start/End: Original strand, 42810805 - 42810839
Alignment:
| Q |
62 |
cagttgaaacctctcctccccggcgatggattcaa |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
42810805 |
cagttgaaacctctcctccctggcgatggattcaa |
42810839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University