View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9984_low_2 (Length: 313)
Name: NF9984_low_2
Description: NF9984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9984_low_2 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 44851518 - 44851206
Alignment:
| Q |
1 |
tttctatatttagtttgaaaggagcttcttggtctataatgatgtcctctgagcagtgtgttgtagattgtaagtaatgaaaattttcttcatttgtaac |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851518 |
tttctatatttagtttgaaaggatcttcttggtctataatgatgtcctctgagcagtgtgttgtagattgtaagtaatgaaaattttcttcatttgtaac |
44851419 |
T |
 |
| Q |
101 |
ttgatcactactactcacagtgctcttattactgttaatctcctcttctacctgtttctgttcttggttttcttccttagaagtaactgggagatctttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851418 |
ttgatcactactactcacagtgctcttattactgttaatctcctcttctacctgtttttgttcttggttttcttccttagaagtaactgggagatctttg |
44851319 |
T |
 |
| Q |
201 |
gttgtttcggttttggattcttttggttgttgagctaaatttgtggtggaggagagggcagtgggatctggatggttatgtgttgaagtataggtgatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851318 |
gttgtttcggttttggattcttttggttgttgagctaaatttgtggtggaggagagggcagtgggatctggatggttatgtgttgaagtataggtgatga |
44851219 |
T |
 |
| Q |
301 |
tgagcaatgaagc |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44851218 |
tgagcaatgaagc |
44851206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University