View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9984_low_3 (Length: 294)
Name: NF9984_low_3
Description: NF9984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9984_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 26 - 291
Target Start/End: Complemental strand, 38829885 - 38829620
Alignment:
| Q |
26 |
tccccataattcctcatgtcgtttgcaactgtcattactcgactaaaataatcagtgatcgattcaccctgcttcattgctaagacctcaaagtctcggc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829885 |
tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggc |
38829786 |
T |
|
| Q |
126 |
gtagacgattaagctgtgctctcttcactcgagcattgccgcgacacttcaacttcatggaatcccatagctatttagatgtctccttctgcgtgatggt |
225 |
Q |
| |
|
||||| |||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| | || |
|
|
| T |
38829785 |
gtagatgattgagttgtgctctcttcactcgagcattgtcgcgacacttcaacttcatggaatcccatagccgtttagatgtctccttctgcgtgttcgt |
38829686 |
T |
|
| Q |
226 |
cttcagaattgacttgtcaattgactgaaacaagtaattcttagccttcaaatccttcagcttcat |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829685 |
cttcagaattgacttgtcaattaactgaaacaagtaattcttagccttcaaatccttcagcttcat |
38829620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University