View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_high_10 (Length: 340)

Name: NF9985A_high_10
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_high_10
NF9985A_high_10
[»] chr5 (1 HSPs)
chr5 (154-208)||(2173890-2173944)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 2173890 - 2173944
Alignment:
154 tttggtaaaatcaatctacattcatctttgtaggaacttcttctctccttctttg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2173890 tttggtaaaatcaatctacattcatctttgtaggaacttcttctctccttctttg 2173944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University