View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_high_28 (Length: 203)

Name: NF9985A_high_28
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_high_28
NF9985A_high_28
[»] chr4 (2 HSPs)
chr4 (160-203)||(9913674-9913717)
chr4 (16-69)||(9913808-9913861)


Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 9913717 - 9913674
Alignment:
160 gtgagacactaaattagagaaattgagtcatgtatgtatacata 203  Q
    |||||||||||||||||||||||||||| |||||||||||||||    
9913717 gtgagacactaaattagagaaattgagtgatgtatgtatacata 9913674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 9913861 - 9913808
Alignment:
16 gaagaatatatattttattcattatgtgactttcttcacttttttgggttcctc 69  Q
    |||||| |||||||||||| | ||||||||| ||||||||||||||||||||||    
9913861 gaagaaaatatattttatttactatgtgactctcttcacttttttgggttcctc 9913808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University