View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_112 (Length: 334)
Name: NF9985A_low_112
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 122 - 329
Target Start/End: Complemental strand, 3195862 - 3195654
Alignment:
| Q |
122 |
actttcactatgtttgtttatgattggtgatataagccaattataacgtcaaagtggtaaatattttttctttggtttatcaacaatcattaggatatct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3195862 |
actttcactatgtttgtttatgattggtgatataagccaattataacgtcaaagtggtaaatattttttctttggtttatcaacaatcattaggatatct |
3195763 |
T |
|
| Q |
222 |
gttggtggttatt-gtttgatgacaacacttgaaaattattttaattggtctcaaacatttggtagttgttccatggttggaaaaacattatagtttgga |
320 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3195762 |
gttggtggttattggtttgatgacaacacttgaaaattattttaattggtctcaaacatttggtagctgttccatggttggaaaaacattatagtttgga |
3195663 |
T |
|
| Q |
321 |
aaagtattt |
329 |
Q |
| |
|
||||||||| |
|
|
| T |
3195662 |
aaagtattt |
3195654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University