View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_157 (Length: 300)
Name: NF9985A_low_157
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_157 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 7 - 168
Target Start/End: Complemental strand, 54236252 - 54236091
Alignment:
| Q |
7 |
agttcagtcacattcgatgaagacagaccaaacaaaaattcaatcatataaaagaaagaaagctgtaatattgatcttattttactatcatcatattatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54236252 |
agttcagtcacattcgatgaagacagaccaaacaaaaattcaatcatataaaagaaagaaagctgtgatattgatcttattttactatcatcatattatc |
54236153 |
T |
|
| Q |
107 |
aatttaacaaccgaattcaatcccgagcttagttagaatgcaacgatatactagctagcttc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54236152 |
aatttaacaaccgaattcaatcccgagcttagttagaatgcaacgatatactagctagcttc |
54236091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 54236008 - 54235945
Alignment:
| Q |
231 |
cagatttgaaccatacaaagaaatgaaaaggactttctaattttgaactatttatattattcga |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54236008 |
cagatttgaaccatacaaagaaatgaaaaggactttctaattttgaactatttatataattcga |
54235945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University