View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_158 (Length: 300)
Name: NF9985A_low_158
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 53096933 - 53096639
Alignment:
| Q |
1 |
atttttcttacttggttgatgactaaagtattttatcatttggttaatacctagacatctttggttgttttaacagaaggtctaacattattgccaggct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096933 |
atttttcttacttgggtgatgactaaagcattttatcatttggttaatacctagacatctttggttgttttaacagaaggtctaacattattgccaggct |
53096834 |
T |
 |
| Q |
101 |
cgacgcatgcaactaatgcttcttgtttgcagtaaatttcttttactcaacttcattttgaccttgttatgtagcctaatttcctccacccccttcattt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096833 |
cgacgtatgcaactaatgcttcttgtttgcagtaaatttcttttactcaacttcattttgaccttgttatgtagcctaatttcctccacccccttcattt |
53096734 |
T |
 |
| Q |
201 |
ctgctcatccaaattcgatggannnnnnnncttaaggtcttctgctgccgctaaagctccacattggctgaatgctgctatttgcaactccaaac |
295 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096733 |
ctgctcatccaaattcgatggattttttttcttaaggtcttctgctgccgctaaagctccacattggctgaatgctgctatttgcaactccaaac |
53096639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University