View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_211 (Length: 269)
Name: NF9985A_low_211
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_211 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 263
Target Start/End: Original strand, 2359424 - 2359682
Alignment:
| Q |
7 |
ttcgtgttgagcagatatcaaatctttatataaaatttgctgttnnnnnnnnntagtcactttaactctgttagcatcttgtcatgtatgcaattttaat |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2359424 |
ttcgtcttgagcagatatcaaatctttatataaaatttgctgttaaaaaaaaataatcactttaactctgttagcatcttgtcatgtatgcaattttaat |
2359523 |
T |
|
| Q |
107 |
attcgtgtaaactaagctaagtataatgaaagttgttaattgcacaaagaaaaatgctatttctcttgataaaatagttcacgaccataccacgaccgaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2359524 |
attcgtgtaaactaagctaagtataatgaaagttgttaattgcacaaagaaaaatgctatttctcctgataaaatagttcacgaccataccacgaccgaa |
2359623 |
T |
|
| Q |
207 |
tgtttcgctaaaaataacacggcttttgcataaaatcgt--aagttctaaagtgtaacc |
263 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2359624 |
tgcttcgctaaaaataacacggcttttgcataaaatcgtccaagttctaaagtgtaacc |
2359682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University