View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_237 (Length: 259)
Name: NF9985A_low_237
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_237 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 135 - 259
Target Start/End: Complemental strand, 9075243 - 9075119
Alignment:
| Q |
135 |
tttaatcgaattccaacccgtttgaatcttgctcataggaatgtgcttcctcctaatgataatttgagttgtgtgctttgtgatttggaggtagaatcaa |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9075243 |
tttaatcgaattccaacccgttcgaatcttgctcataggaatgtgcttcctcctaatgataatttgagttgtgtgctttgtgatttggaggtagaatcaa |
9075144 |
T |
|
| Q |
235 |
aaaaccatttatttgtgcattgtga |
259 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
9075143 |
caaaccatttgtttgtgcattgtga |
9075119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 164
Target Start/End: Complemental strand, 47337471 - 47337317
Alignment:
| Q |
10 |
ataagaagttggaggtgttggcaggaatggggaatgattggggggtagaggagaaaacagtgtttggccaaatatggaagagcccggctccttccatagt |
109 |
Q |
| |
|
|||||||| | |||||| |||| || || | |||||| |||||| ||||||||||| || ||| ||||| | |||||||||||||||||||| | || |
|
|
| T |
47337471 |
ataagaagctagaggtggtggcgggtattgagaatgagtgggggttagaggagaaacatgtctttagccaagtttggaagagcccggctccttctaaggt |
47337372 |
T |
|
| Q |
110 |
ggtggtgctttcttggaagtctctttttaatcgaattccaacccgtttgaatctt |
164 |
Q |
| |
|
||||| ||| ||||||| ||| | ||||||| || || ||||||||||||||| |
|
|
| T |
47337371 |
ggtggcgctctcttggagatctttgcttaatcgtataccgacccgtttgaatctt |
47337317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University