View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_249 (Length: 255)
Name: NF9985A_low_249
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_249 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 104 - 255
Target Start/End: Original strand, 39075349 - 39075499
Alignment:
| Q |
104 |
cgtaggaataacttttctggaaatataaggattatagccttgttcaaaaatattttagaaaatatattccgttaatatgataatattcacnnnnnnntac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
39075349 |
cgtaggaataacttttctggaaatataaggatgatagccttgttcaaaaatattttaaaaaatata-tccgttaatatgataatattcacaaaaaaatac |
39075447 |
T |
 |
| Q |
204 |
ctttataatacagaggttaaatgataatcatacataaatttattctcatcga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39075448 |
ctttataatacagaggttaaatgataatcatacataaatatattctcatcga |
39075499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University