View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_257 (Length: 254)
Name: NF9985A_low_257
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_257 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 38 - 237
Target Start/End: Original strand, 43920705 - 43920899
Alignment:
| Q |
38 |
ccaggggttttcccttctacaacatagcctgcatagccactgctctattcaccaaactttcacaaatctgaatgccttcctactctaacaaatcttgcta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43920705 |
ccaggggttttcccttctacaacatagcctacatagccactgctctattcaccaaactttcacaaatctgaatgccttcctactctaac-----ttgcta |
43920799 |
T |
 |
| Q |
138 |
tactctaattcccctttactatatgaatacagctgttatttcactaacgactcttactactctaattcccctttattatattctatatcctaacagtttg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43920800 |
tactctaattcccctttactatatgaatacagctgttatttcactaacgactcttactactctaattcccctttattatattctatatcctaacagtttg |
43920899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University