View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_262 (Length: 252)
Name: NF9985A_low_262
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_262 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 2727692 - 2727939
Alignment:
| Q |
1 |
gactgacagtataaaaaatctttacactatcggtgcatatacggaattagatccttatagttat--ggaagtttcacgtgctacaattcataccttccta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2727692 |
gactgacagtataaaaaatctttacactgtcggtgcatatacggaattaaatccttatagttatatggaagtttcacgtgctacaattcataccttccta |
2727791 |
T |
 |
| Q |
99 |
atccaaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727792 |
atccaaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaag |
2727891 |
T |
 |
| Q |
199 |
atcaagcaatgcaactccccaatttgtatccataggataaacaccaaa |
246 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727892 |
atcaagtattgcaactccccaatttgtatccataggataaacaccaaa |
2727939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University