View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_273 (Length: 250)
Name: NF9985A_low_273
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_273 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 10343773 - 10344017
Alignment:
| Q |
1 |
tacaactgacaccaagtaccaagacattctcactgtaagcattccccataactacgctgtgaaattgatcgtttagagtgtaattgaggattaannnnnn |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343773 |
tacaactgacaccaattaccaagacattctcactgtaagcattccccataactacgctgtgaaattgatcgtttagagtgtaattgaggattaatttttt |
10343872 |
T |
 |
| Q |
101 |
n-attattgttaatgatattgtgaatttactatgaattaggagaatgtgaaagtatcggaaaatgcatttacacggcgttatgattatcccgtgcttgga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343873 |
ttattattgttaatgatattgtgaatttactatgaattaggagaatgtgaaagtatcggaaaatgcatttacacggcgttatgattatcccgtgcttgga |
10343972 |
T |
 |
| Q |
200 |
tacattactccctggtatgcttttttgttcttgaatgaacaccaa |
244 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343973 |
tacgttactccctggtatgcttttttgttcttgaatgaacaccaa |
10344017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University