View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_280 (Length: 249)
Name: NF9985A_low_280
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_280 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 28137004 - 28136787
Alignment:
| Q |
13 |
aatatggaaccttttgcctttaattttctccgtctcttcttgtttttgtgtatttcagttgcgttcacattcatgtaagtgttcaattccagctatgatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28137004 |
aatatggaaccttttgcctttaattttctctttctcttcttgtttttgtgtattgcagttgcgttcacattcatgtaagtgttcaattccagctatgatt |
28136905 |
T |
|
| Q |
113 |
ttagtattgtttttt-gtgattaaatcaagtattagttgattgaattggaatttatatgtttgttttagtttttaggttgaaatcaatttgaaatttgaa |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28136904 |
ttagtattgtttttttgtgattaaatcaagtattagttgattgaattggaatttatatgtttgttttagtttttaggttgaaatcaatttgaaatttgaa |
28136805 |
T |
|
| Q |
212 |
tcataaatgtgttattgg |
229 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
28136804 |
ttataaatgtgttattgg |
28136787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University