View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_low_287 (Length: 249)

Name: NF9985A_low_287
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_low_287
NF9985A_low_287
[»] chr3 (1 HSPs)
chr3 (165-240)||(50422786-50422861)


Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 165 - 240
Target Start/End: Original strand, 50422786 - 50422861
Alignment:
165 accattagtctcttctatatatgcttatttttagcttatnnnnnnntcgctagatcataaaattttgttcgaacac 240  Q
    |||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
50422786 accattagtctcttctatatatgcttatttttagcttataaaaaaatcgctagatcataaaattttgttcgaacac 50422861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University