View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_low_290 (Length: 249)

Name: NF9985A_low_290
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_low_290
NF9985A_low_290
[»] chr2 (2 HSPs)
chr2 (9-243)||(37766010-37766244)
chr2 (94-226)||(37799519-37799651)
[»] scaffold0280 (1 HSPs)
scaffold0280 (32-218)||(16221-16407)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 37766010 - 37766244
Alignment:
9 gctggtcggacgagatttcggcagggtcctaacaaccatgagaggagccagaggctaccttgctccggagaggatttctggcgtggctattacagccaaa 108  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||    
37766010 gctggtcggacgagatttcagcagggtcctaacaaccatgagaggaacaagaggctaccttgctccggagtggatttctggcgtggctattacagccaaa 37766109  T
109 gccgatgcttatagctacggaatgatgcttttcgaggttgtatcaggtaggaggaactccgatccttcagaagatggtcaagttactttctttcctacct 208  Q
    || |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37766110 gctgatgtttatagctacggaatgatgcttttcgaggttgtatcgggtaggaggaactccgatccatcagaagatggtcaagttactttctttcctacct 37766209  T
209 tagctgcaaaagtagttatagaaggtggaagtgtc 243  Q
    |||||||||||||||||||||||||||||||||||    
37766210 tagctgcaaaagtagttatagaaggtggaagtgtc 37766244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 226
Target Start/End: Complemental strand, 37799651 - 37799519
Alignment:
94 gctattacagccaaagccgatgcttatagctacggaatgatgcttttcgaggttgtatcaggtaggaggaactccgatccttcagaagatggtcaagtta 193  Q
    ||||| ||||||||| | |||| ||| || || |||||||||||||| ||||||||||||||||  ||||| || ||||| || | |||||  |||  ||    
37799651 gctatcacagccaaatctgatgtttacagttatggaatgatgctttttgaggttgtatcaggtaaaaggaattctgatccatctgcagatgaccaaaata 37799552  T
194 ctttctttcctaccttagctgcaaaagtagtta 226  Q
    |||||||||| ||||| ||||| | ||||||||    
37799551 ctttctttccaaccttggctgctacagtagtta 37799519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0280 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: scaffold0280
Description:

Target: scaffold0280; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 32 - 218
Target Start/End: Original strand, 16221 - 16407
Alignment:
32 gggtcctaacaaccatgagaggagccagaggctaccttgctccggagaggatttctggcgtggctattacagccaaagccgatgcttatagctacggaat 131  Q
    ||||||| || |||||||||||| | |||||||| || ||||| ||| ||||||| || || ||||| || || |||||||||| ||| |||||||||||    
16221 gggtcctcactaccatgagaggaacaagaggctatctagctccagagtggatttcaggagttgctataaccgctaaagccgatgtttacagctacggaat 16320  T
132 gatgcttttcgaggttgtatcaggtaggaggaactccgatccttcagaagatggtcaagttactttctttcctaccttagctgcaaa 218  Q
    ||||||||||||| | || |||||||| || |||||||||||||| |||||||| || ||||  |||||||||||||||||||||||    
16321 gatgcttttcgagctagtgtcaggtagaagaaactccgatccttctgaagatggccatgttagattctttcctaccttagctgcaaa 16407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University