View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_308 (Length: 246)
Name: NF9985A_low_308
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_308 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 1956779 - 1956853
Alignment:
| Q |
9 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa |
83 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1956779 |
gagaagaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa |
1956853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 9 - 82
Target Start/End: Original strand, 1941688 - 1941761
Alignment:
| Q |
9 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa |
82 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| | || |||||| |||||||||| |||||||| |
|
|
| T |
1941688 |
gagaagaagataaagggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa |
1941761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 131
Target Start/End: Original strand, 1927578 - 1927701
Alignment:
| Q |
9 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaaat-actaaaacttgttttgttttat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||| ||||| ||||| ||| |||||||||| ||||||||||| | | | | || |||| |||||| |
|
|
| T |
1927578 |
gagaagaagataaagggttttgcaataagtgaaacagcttttacaatatttcttctcatggcatctaggtaaaaaataaattacaattattttattttat |
1927677 |
T |
 |
| Q |
108 |
ttatgtttataccttcataatatt |
131 |
Q |
| |
|
| |||||| ||||||||||||||| |
|
|
| T |
1927678 |
tgatgtttttaccttcataatatt |
1927701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University