View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_321 (Length: 244)
Name: NF9985A_low_321
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_321 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 37492128 - 37492344
Alignment:
| Q |
20 |
catggtgtatgtgcatactgcatagtggttaagatcattctgtttacatttaacttcaaattagaatgatgctactcttatttttgtaatgatgctttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492128 |
catggtgtatgtgcatactgcatagtggttaaaatcattctgtttacatttaatttcaaatcagaatgatgctactcttatttttgtaatgatgctttga |
37492227 |
T |
 |
| Q |
120 |
tttctttggttgttttacttgaaatggcaaaggataaggagcaaagcagttcagattacagaagctgtgttccgtccaatccgatccattctgatccaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37492228 |
tttctttggttgttttacttgaaatggcaaaggataaggagcaaagcagttcagattacagaagctgtgttccgtccaatccgatccattccgatccaat |
37492327 |
T |
 |
| Q |
220 |
ccattccatttcatttc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37492328 |
ccattccatttcatttc |
37492344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University