View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_338 (Length: 241)
Name: NF9985A_low_338
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_338 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 235
Target Start/End: Complemental strand, 10343681 - 10343450
Alignment:
| Q |
4 |
atatgatgaagaaggcaacgattttgatggcaccggaaggtgaggctgagtgagtgagctggtcttgttgtgaggatgagttgatttggcttttccggtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343681 |
atatgatgaagaaggcaacgattttgatggcaccggaaggtgatgctgagtgagtgagctggtcttgttgtgaggatgagttgatttggcttttccggtg |
10343582 |
T |
|
| Q |
104 |
accggaactctgggatgaccggtgttgatctcgcttcttcgccattttccggtggctgaaacacggtgtagtggcttcctcttcctcaggttaaatcagt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10343581 |
accggaactctgggatgaccggtgttgatctcgattcttcgccattttccggtggctgaaacacggtgtagtggcttcctcttcctcaggttaaatcagt |
10343482 |
T |
|
| Q |
204 |
caccgggtaattaaaaatacgtagattcgaat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10343481 |
caccgggtaattaaaaatacgtagattcgaat |
10343450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University