View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_343 (Length: 240)
Name: NF9985A_low_343
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_343 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42601817 - 42601595
Alignment:
| Q |
1 |
gaaatacagaaacttggaagggtctggattggaagtttgagtgaaaaacagcaacaactttttattttgctatcaaatgcatctcgtttacataataatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42601817 |
gaaatacagaaacttggaagggtttggattgggagtttgagtgaaaaacagcaacatctttttattttgctatcaaatgcatctcgtttacataataatt |
42601718 |
T |
|
| Q |
101 |
t-agatacatctcagaaattaccaacttaatgttaaacggatgggtgaatttaattgcaatttaatgaatcattttgaaatgtacataatgtgagaaact |
199 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42601717 |
tcaaatacatctcagaaattaccaacttaatgttaaacggatgggtgaatttaattgcaatttaatgaatcattttgaaatgtacataatgtgagaaact |
42601618 |
T |
|
| Q |
200 |
aatttgatacattgtgacaaaat |
222 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
42601617 |
aatttgatacaatgtgacaaaat |
42601595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University