View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_347 (Length: 239)
Name: NF9985A_low_347
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_347 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 15 - 124
Target Start/End: Complemental strand, 7177277 - 7177168
Alignment:
| Q |
15 |
aaaagagtcctatcgtaaaataattggatttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
114 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177277 |
aaaagagtcatatcataaaataattggctttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
7177178 |
T |
|
| Q |
115 |
taaaaatgca |
124 |
Q |
| |
|
||| |||||| |
|
|
| T |
7177177 |
taacaatgca |
7177168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 174 - 239
Target Start/End: Complemental strand, 7177115 - 7177050
Alignment:
| Q |
174 |
gtcagcaacatctccatcatcctaggccaacaaccttacattggtttatcaacaaatgcatgtcca |
239 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7177115 |
gtcagcaacatctccatcatcctaggacaacaaccttatattggtttagcaacaaatgcatgtcca |
7177050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University