View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_350 (Length: 239)
Name: NF9985A_low_350
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_350 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 7617729 - 7617568
Alignment:
| Q |
1 |
tgtgtagctgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgttcctttatgagcttctgttctgtctttaaagt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
7617729 |
tgtgtagttgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtctttaaagt |
7617630 |
T |
 |
| Q |
101 |
gnnnnnnnnnccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
164 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617629 |
g--aaaaaaaccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
7617568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University