View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_357 (Length: 236)
Name: NF9985A_low_357
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_357 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 46582031 - 46581800
Alignment:
| Q |
1 |
atgttattattatttggatgcttggtgagatgttgttatgagacattctcattctgaaattctctttgtaaaggacgacttatattatatagcagatata |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
46582031 |
atgttattattatttggatgcttgatgagatgttgttatgagacattctcattctgaaattctcgttgtaaaggatgacttatattatatagcagatata |
46581932 |
T |
 |
| Q |
101 |
aagaaatatctgctttgcttatttctttagaaagagaaagggtttaagaattttgtattctttgatannnnnnnnnaatttctcacatatttacttcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46581931 |
aagaaatatctgctttgcttatttctttagaaagagaaagggtttaagaattttgtattctttgatttttttttttaatttctcacatatttacttcact |
46581832 |
T |
 |
| Q |
201 |
agaatagaatcactgtcatactattttcttcg |
232 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
46581831 |
agaatagaatcactgtcatactatttttttcg |
46581800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University