View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_39 (Length: 413)
Name: NF9985A_low_39
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_39 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 25 - 185
Target Start/End: Complemental strand, 33399989 - 33399827
Alignment:
| Q |
25 |
tgaagagattcatttctat--tcttcaagaatttatgtgaagactacaacgaaaagaagccactcttgttagctccccgcatgagaaatgtcattcgggt |
122 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399989 |
tgaaaagattcatttctatgatcttcaagaatttatgtgaagactacaacgaaaagaagccacatttgttagctccccgcatgagaaatgtcattcgggt |
33399890 |
T |
|
| Q |
123 |
gactagaggaaataggaatttggacaatttatagcacctcaaaaggaaggaatcagctgtcct |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399889 |
gactagaggaaataggaatttggacaagttatagcacctcaaaaggaaggaatcagctgtcct |
33399827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 219 - 378
Target Start/End: Original strand, 32493567 - 32493717
Alignment:
| Q |
219 |
atcaagctgcaaggcattttaggcaaacaagtcaaaaattagcaacaaattataggaagaatgagaaagaatttatggaagatttgcccgaaaattagct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
32493567 |
atcaagctgcaaggcattttaggcaaacaagtcaaaaattagcaccaaattataggaagaatgagaaagaatttatggaagatttgcccgaaacttaggt |
32493666 |
T |
|
| Q |
319 |
agtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggc |
378 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32493667 |
agtggaaactaatcc---------caccaaatgcaacatctcaataatggcgctttcggc |
32493717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 292 - 389
Target Start/End: Complemental strand, 33399795 - 33399698
Alignment:
| Q |
292 |
tatggaagatttgcccgaaaattagctagtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggcaacaccgtctt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399795 |
tatggaagatttgcccgaaaattagctagtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggcaacaccgtctt |
33399698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 32492827 - 32492895
Alignment:
| Q |
142 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggagcattgtgtcca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32492827 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggggcattgcgtcca |
32492895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 25 - 92
Target Start/End: Original strand, 32492759 - 32492828
Alignment:
| Q |
25 |
tgaagagattcatttctattcttcaagaatt--tatgtgaagactacaacgaaaagaagccactcttgtt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32492759 |
tgaagagattcatttctattcttcaagaatttatatgtgaagactgcaacgaaaagaagccactcttgtt |
32492828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 413
Target Start/End: Complemental strand, 20287513 - 20287483
Alignment:
| Q |
383 |
ccgtcttgtcacctctgtttgactttcatat |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20287513 |
ccgtcttgtcacctctgtttgactttcatat |
20287483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University