View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_405 (Length: 229)
Name: NF9985A_low_405
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_405 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 2 - 216
Target Start/End: Original strand, 10619665 - 10619883
Alignment:
| Q |
2 |
catacacgacaataacattgacaagtcaacgtcgattttaaaatattaataaatttaatgtaatcacgtgggtcaatgtcaaacattgttttctgtcaca |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619665 |
catacatgacaataacattgacaagtcaacgtcgattttaaaatatgaataaatttaatgtaatcacgtgggtcaatgtcaaacattgttttctgtcaca |
10619764 |
T |
|
| Q |
102 |
acgcacatgccttctatcagaagttacaatgcagcaatgactatgaacctgtatacgaaagcaaaatgcgcagatctaattttcaatcgatatggtc--- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10619765 |
acgcacatgccttctatcagaagttacaatgcagcaatgactatgaacctgtatacgaaagcaaaatgcgcagatctaatttgcaatcgatatggtcgca |
10619864 |
T |
|
| Q |
199 |
-ttacagttgtgatgtcca |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10619865 |
attacagttgtgatgtcca |
10619883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University