View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_406 (Length: 229)
Name: NF9985A_low_406
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_406 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 15827790 - 15827576
Alignment:
| Q |
1 |
gtgttctgtttatattgtgttttgtttgctgttttcattataacttagttgttagttgnnnnnnnnnntcactcctagttatggattgctattttaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15827790 |
gtgttctgtttatattgtgttttgtttgctgttttcattataacttagttgttagttggaaaaaaaaatcactcctagttatggattgctattttaacta |
15827691 |
T |
 |
| Q |
101 |
tttgaaagcaagacctttttagccacaaattttattacgatttctatggggttgagaatacaataggtcgcaatgnnnnnnntttcatgtccatcaaaat |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
15827690 |
tttgaaagcaagaccttttcagccacaaattttattacgatttctatggggttgagaatacaataggtcacaatgaaacaaatttcatgtccatcaaaat |
15827591 |
T |
 |
| Q |
201 |
acaaaatgttggtta |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15827590 |
acaaaatgttggtta |
15827576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University