View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_408 (Length: 229)
Name: NF9985A_low_408
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_408 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 2943709 - 2943491
Alignment:
| Q |
1 |
atcaacattttctgtatacacgtcagaaataagaatatattaagcttcaactttacctgcacaggaatatttggaagcttggtcggtgcttgggtaaatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943709 |
atcaacattttctgtatacatgtcagaaataacaatatattaagcttcaactttacctgcacaggaatatttggaagcttggtcggtgcttgggtaaatt |
2943610 |
T |
 |
| Q |
101 |
ttgaatgatcgggttgtaacctcatttggcttcatgatcaaaaattgctcctgaacagtgttcaataaaaattaaatacctaaacttgaagatcaatgaa |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943609 |
ttgaatgatcgggttgtaatctcatttggcttcatgatcaaaaattgctcctgaacagtgttcaataaaaattaaatacctaaacttgaagatcaatgaa |
2943510 |
T |
 |
| Q |
201 |
actatacaactggaatggt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2943509 |
actatacaactggaatggt |
2943491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University