View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_421 (Length: 226)
Name: NF9985A_low_421
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_421 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 24 - 183
Target Start/End: Complemental strand, 3758573 - 3758409
Alignment:
| Q |
24 |
atttttctactcaattactata----gtttctctacctttcacaaaaatattacaagcaattcttaacatggaccccatttgattcataaccattaa-nn |
118 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3758573 |
atttttttactcaattactatatatagtttctctacctttcacaaaaatattacaagcaattcttaacatggaccccatttgattcataaccattaattt |
3758474 |
T |
 |
| Q |
119 |
nnnnnnnnnnnnnnnnngagggaaattcataaccattaattgtttattcttcacctcatccaatt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3758473 |
tttttctttttttttttgagggaaattcataaccattaattgtttattcttcacctcatccaatt |
3758409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University