View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_422 (Length: 226)
Name: NF9985A_low_422
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_422 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 11024029 - 11024244
Alignment:
| Q |
11 |
aagaaggtgaagatgaagataattggttaccaaaaggttttaccgagaggatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagc |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024029 |
aagaaggagaagatgaagataattggttaccaaaaggttttgtagagaggatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagc |
11024128 |
T |
|
| Q |
111 |
gttaatattggatcatccatcgataggcggattcttaacgcattgtggctggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024129 |
gttaatattggatcatccatcgataggcggattcttaacgcattgtggctggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatg |
11024228 |
T |
|
| Q |
211 |
cccggattcggggatc |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11024229 |
cccggattcggggatc |
11024244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University