View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_426 (Length: 226)
Name: NF9985A_low_426
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_426 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 10922336 - 10922112
Alignment:
| Q |
1 |
tgctgcaacggattttggatatatactcgtaccttgtgaatgataagcattggtgatggtacattatacaggtagtatacatagaaaatcgtctatagtt |
100 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10922336 |
tgctgcaactgattttgtatatatactcgtaccttgtgaatgataagcgttggtgatggtaaattatacaggtagtatacatagaaaatcgactatagtt |
10922237 |
T |
|
| Q |
101 |
gttaaaccaattgaatctgtggttagacttgattttcacaa-----caataaatacgatatgtatctacaaattttgcctccaataggcggtgaggttga |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10922236 |
gttaaaccaattgaatctgtggttcgacttgattttcacaacactgcaataaatacgatatgtatctacaaattttgcctccaataggcggtgaggttga |
10922137 |
T |
|
| Q |
196 |
attttgataacatgaaataagcact |
220 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
10922136 |
agtttgataacatgaaataagcact |
10922112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 170
Target Start/End: Complemental strand, 10951130 - 10951102
Alignment:
| Q |
142 |
caataaatacgatatgtatctacaaattt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10951130 |
caataaatacgatatgtatctacaaattt |
10951102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University