View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_428 (Length: 225)
Name: NF9985A_low_428
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_428 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 29280299 - 29280376
Alignment:
| Q |
1 |
agtgagtcaacataagttcttggaccatggtactaatttggttacttttattctttttgattgagtataggaacaacc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280299 |
agtgagtcaacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtataggaacaacc |
29280376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University