View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_low_429 (Length: 225)

Name: NF9985A_low_429
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_low_429
NF9985A_low_429
[»] chr8 (1 HSPs)
chr8 (24-162)||(38243852-38243990)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 24 - 162
Target Start/End: Original strand, 38243852 - 38243990
Alignment:
24 taggaactgacgggtttttgatagaaatggaacaaggaaggaccgaggaactgtttacgcttggcgaaaacttcatcggcggatggtccataatacggat 123  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
38243852 taggaactgacgggtttttgatagaaatggaacaaggaaggaccaaggaactgtttacgcttggagaaaacttcatcggcggatggtccataatacggat 38243951  T
124 gaggttggtgatcgaaaggcggtatctgcggcggtggcg 162  Q
    |||||||||||||||| ||||||||||||||||||||||    
38243952 gaggttggtgatcgaacggcggtatctgcggcggtggcg 38243990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University