View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_429 (Length: 225)
Name: NF9985A_low_429
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_429 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 24 - 162
Target Start/End: Original strand, 38243852 - 38243990
Alignment:
| Q |
24 |
taggaactgacgggtttttgatagaaatggaacaaggaaggaccgaggaactgtttacgcttggcgaaaacttcatcggcggatggtccataatacggat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243852 |
taggaactgacgggtttttgatagaaatggaacaaggaaggaccaaggaactgtttacgcttggagaaaacttcatcggcggatggtccataatacggat |
38243951 |
T |
 |
| Q |
124 |
gaggttggtgatcgaaaggcggtatctgcggcggtggcg |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38243952 |
gaggttggtgatcgaacggcggtatctgcggcggtggcg |
38243990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University