View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_440 (Length: 222)
Name: NF9985A_low_440
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_440 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 29 - 199
Target Start/End: Original strand, 47436708 - 47436878
Alignment:
| Q |
29 |
taacagagaccagaggaaatacacatttatttttaagggttcaccatgcatgtaagatctcacatttcaatagggttttcataatcctttaccttaattt |
128 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436708 |
taaccgagaccagaggaaatacacatttatttttaagggttcaccgtgcatgtaagatctcaaatttcaatagggttttcataatcctttaccttaattt |
47436807 |
T |
 |
| Q |
129 |
ggttgcgcttgttttgaaaccagaacttgatttgcgtcggtgtaagacctagctcacaactcaattgtttc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
47436808 |
ggttgcgcttgttttgaaactagaacttgatttgcgcaggtgtaaggcctagctcacaactcaattgtttc |
47436878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University