View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_441 (Length: 222)
Name: NF9985A_low_441
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_441 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 25 - 191
Target Start/End: Original strand, 45123006 - 45123172
Alignment:
| Q |
25 |
agaacaagataagcaaggttgtttcgtgatctttgcaagaagaacaaggtgattcctccacttatttactttattgcttgacaagtcttgtaggtgacaa |
124 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123006 |
agaacaagataaacaaggttgtttcgtgatctttgtaagaagaacaagatgattcctccacttgtttactttattgcttgacaagtcttgtaggtgacaa |
45123105 |
T |
|
| Q |
125 |
tattgtttcttgaagtgcaaagcaaacaaagtgatacttatatataagctcgatttctgtatttcaa |
191 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45123106 |
tattgtttcttgaagtgcaagacaaacaaagtgatacctatatataagctcgatttctgtatttcaa |
45123172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 118
Target Start/End: Original strand, 34980546 - 34980595
Alignment:
| Q |
69 |
caaggtgattcctccacttatttactttattgcttgacaagtcttgtagg |
118 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
34980546 |
caaggtgattccttcacttgtttactttcttgcttggcaagtcttgtagg |
34980595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 142
Target Start/End: Complemental strand, 15549756 - 15549684
Alignment:
| Q |
70 |
aaggtgattcctccacttatttactttattgcttgacaagtcttgtaggtgacaatattgtttcttgaagtgc |
142 |
Q |
| |
|
|||||| ||| | ||||| ||| |||| |||| |||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
15549756 |
aaggtggttcattcacttgtttcctttcttgcatgacaagtattgtaggccacaatgttgtttcttgaagtgc |
15549684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University