View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_442 (Length: 222)
Name: NF9985A_low_442
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_442 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 3429497 - 3429300
Alignment:
| Q |
1 |
agacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactcttactccctccttatggcacactccaatcccatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429497 |
agacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaatcccatat |
3429398 |
T |
|
| Q |
101 |
ctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429397 |
ctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatgg |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 3426018 - 3425822
Alignment:
| Q |
1 |
agacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactcttactccctccttatggcacactccaatcccatat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| |||||| || ||| ||||||||||||||||||||| |||||| |
|
|
| T |
3426018 |
agacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgccatat |
3425919 |
T |
|
| Q |
101 |
ctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
197 |
Q |
| |
|
||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||||| |
|
|
| T |
3425918 |
ctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University