View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_455 (Length: 217)
Name: NF9985A_low_455
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_455 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 38807017 - 38807200
Alignment:
| Q |
19 |
acttttagcatatcttgttcttggaaagaattcaaacaaacaacacaacccttcacactttgatgattatcatcatcactttctccttttgtgaattgaa |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38807017 |
acttttagcatatcatgttcttggaaagaattcaaacaaacaacacaaccctttacactttgatgattatcatcatcaccttctccttttgtgaattgaa |
38807116 |
T |
 |
| Q |
119 |
atgttggtattccttggatgacggattcatcgacgccgcgggtccaaatccttggagagaatgctatgaagggttcttcatttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38807117 |
atgttggtattccttggatgacggattcatcgacgccgcgagtccaaatccttggagagaatgctatgaagggttcttcatttt |
38807200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University