View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_459 (Length: 215)
Name: NF9985A_low_459
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_459 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 14321448 - 14321271
Alignment:
| Q |
13 |
atggacatcatgtgtcgcctttctaccggtggtaaaagcatcggctacttcccaaccttcttcggttgtcctcttagatgtagtcgacttaaaggtttgt |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14321448 |
atggacattgtgtgtcgcctttctaccggtggtacaagcatcggctacttcccaaccttcttcggttgtcctcttagatgtcgtcgacttaaaggtttgt |
14321349 |
T |
|
| Q |
113 |
caagggtcgtgatgcggtgttgtatctagtttatggatggttggtggcaatttgttttaagatctaccgcctccgtgc |
190 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
14321348 |
caagggtcgcgatgcggtgttgtatctagtttctggatggttggtgacaatttgttttaagatctaccacctccgtgc |
14321271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 185
Target Start/End: Original strand, 41907708 - 41907831
Alignment:
| Q |
62 |
tcccaaccttcttcggttgtcctcttagatgtagtcgacttaaaggtttgtcaagggtcgtgatgcggtgttgtatctagtttatggatggttggtggca |
161 |
Q |
| |
|
||||||| |||| ||||||||||||| |||| || |||| |||||||| ||||||| ||||| ||||||||||| ||||| | |||||||| |||| |
|
|
| T |
41907708 |
tcccaacattctccggttgtcctcttcgatgccgttgactgaaaggttttccaagggttgtgatatggtgttgtatccagtttctagatggttgctggcg |
41907807 |
T |
|
| Q |
162 |
atttgttttaagatctaccgcctc |
185 |
Q |
| |
|
|| |||||| |||| ||||||||| |
|
|
| T |
41907808 |
atctgttttcagatttaccgcctc |
41907831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University