View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_468 (Length: 212)
Name: NF9985A_low_468
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_468 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 43 - 193
Target Start/End: Complemental strand, 6416497 - 6416347
Alignment:
| Q |
43 |
gggcgttgcaattgcacttgcggggaattcaatgttgccacattgttccccgccactactgtcacgaaactttttgtttgcttcttgaggattgatagct |
142 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |||| ||| |
|
|
| T |
6416497 |
gggcgttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgatacttgttgtttgcttcgtgaggactgatggct |
6416398 |
T |
|
| Q |
143 |
actgttgcatccgctaagtttaaggtttggaatgaacaagacgacatatgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6416397 |
actgttgcatccgctaagtttaaggtttagaatgaacaagacgacatatgt |
6416347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 6379149 - 6379186
Alignment:
| Q |
8 |
catagactaagaagtgtgactagagcaaccaaaagggg |
45 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6379149 |
cataggctaagaagtgtgactagagcaaccaaaagggg |
6379186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University