View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985A_low_468 (Length: 212)

Name: NF9985A_low_468
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985A_low_468
NF9985A_low_468
[»] chr7 (2 HSPs)
chr7 (43-193)||(6416347-6416497)
chr7 (8-45)||(6379149-6379186)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 43 - 193
Target Start/End: Complemental strand, 6416497 - 6416347
Alignment:
43 gggcgttgcaattgcacttgcggggaattcaatgttgccacattgttccccgccactactgtcacgaaactttttgtttgcttcttgaggattgatagct 142  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |||| |||    
6416497 gggcgttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgatacttgttgtttgcttcgtgaggactgatggct 6416398  T
143 actgttgcatccgctaagtttaaggtttggaatgaacaagacgacatatgt 193  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||    
6416397 actgttgcatccgctaagtttaaggtttagaatgaacaagacgacatatgt 6416347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 6379149 - 6379186
Alignment:
8 catagactaagaagtgtgactagagcaaccaaaagggg 45  Q
    ||||| ||||||||||||||||||||||||||||||||    
6379149 cataggctaagaagtgtgactagagcaaccaaaagggg 6379186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University