View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_473 (Length: 210)
Name: NF9985A_low_473
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_473 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 30 - 210
Target Start/End: Complemental strand, 14801843 - 14801663
Alignment:
| Q |
30 |
ttaagtaccaggcaaaataccgttatgatcaacaacaaaaatcgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801843 |
ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag |
14801744 |
T |
|
| Q |
130 |
ccttatgtggctgtgtgatcacaattattgcaaatggagcttcttaacttgtttattattgtaaatggaagcgttttccta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14801743 |
tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttccta |
14801663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University