View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_475 (Length: 208)
Name: NF9985A_low_475
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_475 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 51365472 - 51365683
Alignment:
| Q |
1 |
gccattctacaccttata----ttttggtattttataggattaaatttgtagtaggaacccaaattttaaaagctggcttgtgagatattgtttatactt |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51365472 |
gccattctacaccttatatatattttggtattttataggattaaatttgtagtaggaatccaaatttcaaaagctggcttgtgagatattgtttatactt |
51365571 |
T |
 |
| Q |
97 |
aaatgtccagtgcttgcttcactacctcctacagtgtatttatccctttcctttagcacacaatgcatgttttcacgctcaagaatgcaaatagctttca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51365572 |
aaatgtccagtgcttgcttcactacctcctacagtgtatttatccctttcctttagcacacaatgcatgttttcacgctcaacaatgcaaatagctttca |
51365671 |
T |
 |
| Q |
197 |
tactaacttttc |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51365672 |
tactaacttttc |
51365683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University