View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_482 (Length: 206)
Name: NF9985A_low_482
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_482 |
 | |
|
| [»] chr1 (5 HSPs) |
| |
|
| [»] scaffold0432 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 5 - 206
Target Start/End: Complemental strand, 9804882 - 9804681
Alignment:
| Q |
5 |
tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatctcagtgaagtttcatggttcttttttct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804882 |
tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatctcagtgaagtttcatggttcttttttct |
9804783 |
T |
|
| Q |
105 |
gatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9804782 |
gatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgtttagggtttcaagagaatgagaaatgagga |
9804683 |
T |
|
| Q |
205 |
tg |
206 |
Q |
| |
|
|| |
|
|
| T |
9804682 |
tg |
9804681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 97 - 206
Target Start/End: Complemental strand, 9817693 - 9817584
Alignment:
| Q |
97 |
ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
9817693 |
ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga |
9817594 |
T |
|
| Q |
197 |
aatgaggatg |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
9817593 |
aatgaggatg |
9817584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 94 - 205
Target Start/End: Complemental strand, 9817577 - 9817466
Alignment:
| Q |
94 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
193 |
Q |
| |
|
||||||| | |||| ||||||||||||| |||||| ||||||||||||||||| | ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9817577 |
ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg |
9817478 |
T |
|
| Q |
194 |
agaaatgaggat |
205 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9817477 |
agaaatgaggat |
9817466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 9817448 - 9817347
Alignment:
| Q |
104 |
tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg |
203 |
Q |
| |
|
||||||||||||||| ||| ||||||| || |||||||||||||| ||||| |||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
9817448 |
tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg |
9817350 |
T |
|
| Q |
204 |
atg |
206 |
Q |
| |
|
||| |
|
|
| T |
9817349 |
atg |
9817347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9817812 - 9817777
Alignment:
| Q |
1 |
gaagtttcatgaaaactccatcaaaagagataacca |
36 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9817812 |
gaagtttcatgaaaattccatcaaaagagataacca |
9817777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 90 - 206
Target Start/End: Complemental strand, 11708 - 11592
Alignment:
| Q |
90 |
atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag |
189 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||| || |||||||||||| | ||| ||||| || |||| ||||||| | | |||||||| |
|
|
| T |
11708 |
atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag |
11609 |
T |
|
| Q |
190 |
aatgagaaatgaggatg |
206 |
Q |
| |
|
|||| ||| |||||||| |
|
|
| T |
11608 |
aatgggaagtgaggatg |
11592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 206
Target Start/End: Complemental strand, 11585 - 11473
Alignment:
| Q |
94 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
193 |
Q |
| |
|
||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || || ||||||||||| | ||| | || ||||| |||||| |
|
|
| T |
11585 |
ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata |
11486 |
T |
|
| Q |
194 |
agaaatgaggatg |
206 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11485 |
agaaatgaggatg |
11473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 11820 - 11788
Alignment:
| Q |
1 |
gaagtttcatgaaaactccatcaaaagagataa |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11820 |
gaagtttcatgaaaactccatcaaaagagataa |
11788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University