View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_492 (Length: 203)
Name: NF9985A_low_492
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_492 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 9913717 - 9913674
Alignment:
| Q |
160 |
gtgagacactaaattagagaaattgagtcatgtatgtatacata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9913717 |
gtgagacactaaattagagaaattgagtgatgtatgtatacata |
9913674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 9913861 - 9913808
Alignment:
| Q |
16 |
gaagaatatatattttattcattatgtgactttcttcacttttttgggttcctc |
69 |
Q |
| |
|
|||||| |||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
9913861 |
gaagaaaatatattttatttactatgtgactctcttcacttttttgggttcctc |
9913808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University