View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_500 (Length: 201)
Name: NF9985A_low_500
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_500 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 27 - 186
Target Start/End: Complemental strand, 36930708 - 36930549
Alignment:
| Q |
27 |
ccacaccacacagctattgttgtaccttgttaatgttgttttccgtgattcagccatgcacgcattgaaggtccaggcatagcagctatcccattcttat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930708 |
ccacaccacacagctattgttgtaccttgttaatgttgttttccgtcattcagccatgcacgcattgaaggtccaggcatagcagctatcccattcttat |
36930609 |
T |
|
| Q |
127 |
gaaattattttgatgtgaaataatatgttattcgatttttatatgtattttgtctatggt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
36930608 |
gaaattattttgatgtgaaataatatgttattcgatttttatatgtatttagtttatggt |
36930549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University